This track shows the locations of CRISPR detection guides and flanking primers. There are three studies on this topic, with the one by Mammoth Biosciences the most advanced. The Broad Institute's guides were validated, the NYU guides are predictions for now.
Prefix | Institution | Overview | Links |
---|---|---|---|
Mammoth | Mammoth Biosciences |
There are three guides in the set, two are shown on the genome. The third guide detects human RNAseP, as a sample control. Target sequence: TAATTTCTACTAAGTGTAGATAATTACTTGGGTGTGACCCT |
Protocol and preprint. |
Broad | Sabeti Lab, Broad Institute | Various guides are predicted, the one shown here is from the protocol. | Protocol from Mar 21 2020, Guide website and preprint. |
NYU | Sanjana Lab, New York University | These are predictions by a new algorithm. Shown is the prediction with the highest score. | Website |